Design DNA and mRNA
on your own machine.


Search a real antigen, codon-optimize it for the animal you're targeting, then assemble the mRNA construct, fold it, simulate the manufacturing run and price out the order. It all happens in one window on your own machine, with 350+ tools underneath when you need them.

Free while in development · macOS & Windows · your sequences stay on your computer

5′-ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTAC…-3′
Nucleora home dashboard — the guided three-step vaccine design workflow
350+
tools across the workbench
100%
local, nothing uploaded
3 steps
antigen → mRNA → export
A–D
graded manufacturability report
What it does

The whole workflow, one window

No stitching together five web tools and a spreadsheet. The design, the analysis and the numbers stay in one place, computed on your machine with BioPython, ViennaRNA and real codon-usage tables.

Codon optimization

Re-code a protein for any host, including elephants, okapi and other conservation species. Real tables where they exist, clade-proxy where they don't, with a live before/after readout.

mRNA construct design

Assemble T7 promoter, 5′UTR, Kozak, signal peptide, antigen ORF, 3′UTR and poly(A) into a therapeutic-style mRNA, with every part's provenance cited.

RNA folding

Fold with the ViennaRNA engine for secondary structure, minimum free energy, and dsRNA/hairpin immunogenicity risk. Computed locally.

IVT simulation & manufacture

Walk the construct through an in-vitro-transcription run, get a graded manufacturability report, then estimate yield, kinetics, and an itemized order form.

Cloning & primers

Restriction mapping, Gibson and Golden Gate assembly, and primer design via primer3, with a built-in fallback for platforms where primer3 has no prebuilt wheel.

Lab bench, in silico

Virtual agarose gels, in-silico PCR, peptide property calculators, and pairwise or multiple alignment. The everyday bench assays, simulated.

Built for conservation

Built for the animals that don't have a codon table yet

Codon choice has to match the animal being dosed. Nucleora ships real codon tables built from NCBI RefSeq coding sequences for African elephant, Asian elephant and cattle. Where a species like okapi or bongo has almost no sequenced genes, it optimizes against a documented clade-anchored proxy and tells you that is what it did, rather than pretending the data exists.

real dataAfrican & Asian elephant, cattle, primates, big cats and more
proxyokapi, bongo: clade-anchored to a documented relative, never silent
Target-species picker showing real vs proxy codon data for conservation species

Local-first, and honest about it

What Nucleora is

  • A design workbench for DNA and mRNA built on public reference genomes.
  • Local-first. Your sequences are processed on your machine, not uploaded to a server.
  • Method-transparent. Every number traces to a named, published algorithm.
  • Cross-platform. The same app on macOS and Windows.

What it isn't

  • Not a medical device and not a source of clinical or diagnostic advice.
  • Not a wet-lab substitute. Designs still need real validation at the bench.
  • Not a data-harvesting cloud. Nothing leaves your computer unless you fetch a public record.
  • Not locked-in. Export standard sequence, GenBank and GFF3 formats any time.

See it run on real data

A real walkthrough of the Nucleora interface, with genuine ViennaRNA folding, codon optimization and manufacturability scoring. No mockups.

Watch the demo